Log 3446346

D	M	Title	Map	Format	RS	BS	Duration	Date	Duplicate of
		serveme.tf #1340967	cp_process_f12	Sixes	1	3	29:19
					0	1	6:40
					0	2	5:52
					0	3	5:41
					1	3	3:54
					1	3	7:12

Log id: Add log

Players

Team	Player	Classes	K	D	A	DA/M	DT/M	HR/M	DA	DT	HR	K/1	AS	MS	HSK	CPC	Time Played
Red	rm -rf /*		15	22	7	193	194		5671	5698	0	3	0	25	0	9	29:19
			15	22	7	193			5671								29:19
	Weapon		K	Acc		DA/S			DA
	Scattergun		14	76%		14			5515
	Pistol		1	20%		3			156
Red	technical.		23	15	12	265	213		7775	6263	0	6	0	21	0	10	29:19
			23	15	12	265			7775								29:19
	Weapon		K	Acc		DA/S			DA
	Scattergun		22	68%		18			7583
	Pistol		1	20%		2			192
Red	`.`		30	15	5	387	339		11356	9940	0	6	4	26	0	2	29:15
			30	15	5	388			11356								29:15
	Weapon		K	Acc		DA/S			DA
	Rocket		26	52%		33			9484
	Original		2	41%		25			1872
	Environment		2						0
Red	wardex		20	31	5	249	312		7312	9164	0	2	1	71	0	2	29:19
			20	31	5	249			7312								29:19
	Weapon		K	Acc		DA/S			DA
	Rocket		20	53%		39			7312
Red	Pipoex		13	17	8	306	289		8979	8499	0	3	0	31	0	6	29:12
			13	17	8	307			8979								29:12
	Weapon		K	Acc		DA/S			DA
	Stickybomb		8	20%		12			6028
	Iron Bomber		4	24%		17			2951
	Environment		1						0
Red	639 Hz		0	10	9	11	130		332	3839	0	0	1	6	0	8	29:19
			0	10	9	11			332								29:19
	Weapon		K	Acc		DA/S			DA
	Crusader's Crossbow		0	59%		2			332
Blue	wargasm		31	21	8	292	230		8580	6754	0	5	0	49	0	11	29:19
			31	21	8	292			8580								29:19
	Weapon		K	Acc		DA/S			DA
	Scattergun		29	73%		19			8320
	Pistol		1	16%		2			225
	Boston Basher		1						35
Blue	Supreme		18	15	5	160	189		4693	5544	0	5	0	25	4	4	29:19
			10	12	4	145			3318								22:52
	Weapon		K	Acc		DA/S			DA
	Scattergun		10	51%		9			3033
	AWPer Hand		0	43%		36			258
	Pistol		0	10%		1			27
			8	3	1	213			1375								6:27
	Weapon		K	Acc		DA/S			DA
	AWPer Hand		7	31%		31			1303
	SMG		1	16%		1			72
Blue	bohoc		22	16	7	327	252		9615	7393	0	4	2	95	0	6	29:19
			22	16	7	327			9615								29:19
	Weapon		K	Acc		DA/S			DA
	Original		20	44%		28			9615
	Environment		2						0
Blue	2pac		12	19	7	282	257		8277	7552	0	3	0	50	2	5	29:19
			10	18	7	278			7453								26:45
	Weapon		K	Acc		DA/S			DA
	Rocket		10	40%		23			7453
			2	1	0	321			824								2:34
	Weapon		K	Acc		DA/S			DA
	Sniper Rifle		2	27%		54			824
Blue	:D		27	19	14	402	344		11792	10103	0	4	4	32	0	5	29:19
			27	19	14	402			11792								29:19
	Weapon		K	Acc		DA/S			DA
	Stickybomb		16	26%		20			7438
	Iron Bomber		9	24%		20			4354
	Environment		2						0
Blue	Muffinz		0	11	19	15	139		446	4079	0	0	0	8	0	6	29:19
			0	11	19	15			446								29:19
	Weapon		K	Acc		DA/S			DA
	Crusader's Crossbow		0	56%		2			381
	Ubersaw		0						65
Team	Player	Classes	K	D	A	DA/M	DT/M	HR/M	DA	DT	HR	K/1	AS	MS	HSK	CPC	Time Played

Totals

Team/Round	K	D	A	DA/M	DT/M	HR/M	DA	DT	HR	K/1	AS	MS	HSK	CPC	Ü	Duration
Red	101	110	46	1413	1480	1120	41425	43403	32852	6	6	180	0	37	10	29:19
1	19			1349			8998								3	6:40
2	21			1334			7830								1	5:52
3	19			1367			7773								2	5:41
4	20			1578			6157								1	3:54
5	22			1481			10667								3	7:12
Blue	110	101	60	1480	1413	1001	43403	41425	29350	5	6	259	6	37	11	29:19
1	24			1352			9019								2	6:40
2	28			1716			10072								2	5:52
3	22			1451			8248								2	5:41
4	10			1278			4986								2	3:54
5	26			1538			11078								3	7:12

Medics

Team	Player	Class	H%	H/M	H	Ü	MÜ	KÜ	OÜ	D	AL	BAL	DAÜ	DBÜ	Time Played
Red	639 Hz		100%	1120	32852	18	18	0	0	0	1	0:15	4	0	29:19
Red	`.`		33%	376	10998										29:15
Red	Pipoex		26%	291	8512										29:12
Red	technical.		19%	215	6321										29:19
Red	wardex		12%	130	3827										29:19
Red	rm -rf /*		10%	108	3194										29:19
Blue	Muffinz		100%	1001	29350	21	7	14	0	0	0	0:00	8	0	29:19
Blue	:D		35%	349	10241										29:19
Blue	bohoc		21%	214	6278										29:19
Blue	2pac		19%	186	5474										29:19
Blue	Supreme		13%	134	3956										29:19
Blue	wargasm		12%	116	3401										29:19

Events

Kills

Team	Player	Scout	Soldier	Pyro	Demo	Heavy	Engineer	Medic	Sniper	Spy	Total
Blue	wargasm	11	12	0	7	0	0	1	0	0	31
Red	`.`	11	12	0	3	0	0	3	1	0	30
Blue	:D	8	10	0	3	0	0	6	0	0	27
Red	technical.	10	7	0	4	0	0	2	0	0	23
Blue	bohoc	8	11	0	2	0	0	1	0	0	22
Red	wardex	3	5	0	6	0	0	4	2	0	20
Blue	Supreme	7	7	0	2	0	0	2	0	0	18
Red	rm -rf /*	5	5	0	4	0	0	1	0	0	15
Red	Pipoex	4	5	0	2	0	0	1	1	0	13
Blue	2pac	3	6	0	3	0	0	0	0	0	12

Deaths

Team	Player	Scout	Soldier	Pyro	Demo	Heavy	Engineer	Medic	Sniper	Spy	Total
Red	wardex	12	11	0	7	0	0	0	1	0	31
Red	rm -rf /*	9	7	0	3	0	0	0	3	0	22
Blue	wargasm	11	8	0	2	0	0	0	0	0	21
Blue	2pac	6	12	0	1	0	0	0	0	0	19
Blue	:D	8	9	0	2	0	0	0	0	0	19
Red	Pipoex	8	4	0	3	0	0	0	2	0	17
Blue	bohoc	6	6	0	4	0	0	0	0	0	16
Red	technical.	5	4	0	5	0	0	0	1	0	15
Red	`.`	5	5	0	3	0	0	0	2	0	15
Blue	Supreme	4	8	0	3	0	0	0	0	0	15
Blue	Muffinz	3	7	0	1	0	0	0	0	0	11
Red	639 Hz	2	1	0	6	0	0	0	1	0	10

Assists

Team	Player	Scout	Soldier	Pyro	Demo	Heavy	Engineer	Medic	Sniper	Spy	Total
Blue	:D	14	17	0	4	0	0	6	0	0	41
Blue	wargasm	15	15	0	7	0	0	2	0	0	39
Red	technical.	13	14	0	5	0	0	3	0	0	35
Red	`.`	13	13	0	4	0	0	4	1	0	35
Blue	bohoc	11	13	0	3	0	0	2	0	0	29
Red	wardex	4	7	0	8	0	0	4	2	0	25
Blue	Supreme	8	11	0	2	0	0	2	0	0	23
Red	rm -rf /*	11	5	0	5	0	0	1	0	0	22
Red	Pipoex	5	8	0	6	0	0	1	1	0	21
Blue	Muffinz	5	9	0	3	0	0	2	0	0	19
Blue	2pac	4	9	0	5	0	0	1	0	0	19
Red	639 Hz	2	3	0	2	0	0	2	0	0	9

Killstreaks

serveme.tf #1340967

Time	Team	Player	Kills
6:06	Blue	:D	4
7:29	Blue	Supreme	3
11:18	Red	`.`	3
15:33	Blue	:D	4
17:00	Blue	:D	3
22:23	Red	`.`	4

Chat

serveme.tf #1340967

Team	Player	Message
Red	`.`	ACCGTGTGTACAGCATCGCACATCAGCCTTTTTT
Red	Pipoex	is it dna sequence?
Red	`.`	nigga gene
Red	`.`	2PAC DOWN GUYS PUSH TO THE STUDIO
Red	wardex	my cat is so annoying
Red	wardex	he wants 50 meals a day
Red	Pipoex	GTCCATCTGTGCATACT
Red	639 Hz	gigacat
Red	technical.	8)
Red	wardex	i knew it too T_T
	Console	Thanks for using serveme.tf technical.! Have you considered donating to keep this service alive?
Red	`.`	-155?
Red	Pipoex	:D:D:D
Red	Pipoex	uhuhuuuuuuuuuuuu
Red	wardex	aw cmon
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
	Console	WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Red	Pipoex	gg
Red	rm -rf /*	gg
Red	technical.	gg
Blue	wargasm	gg