Log 3446346

D M Title Map Format RS BS Duration Date Duplicate of
serveme.tf #1340967 cp_process_f12 Sixes 1 3 29:19

Players

Team Player Classes K D A DA/M DT/M HR/M DA DT HR K/1 AS MS HSK CPC Time Played
Red rm -rf /* Scout 15 22 7 193 194 5671 5698 0 3 0 25 0 9 29:19
Red technical. Scout 23 15 12 265 213 7775 6263 0 6 0 21 0 10 29:19
Red `.` Soldier 30 15 5 387 339 11356 9940 0 6 4 26 0 2 29:15
Red wardex Soldier 20 31 5 249 312 7312 9164 0 2 1 71 0 2 29:19
Red Pipoex Demo 13 17 8 306 289 8979 8499 0 3 0 31 0 6 29:12
Red 639 Hz Medic 0 10 9 11 130 332 3839 0 0 1 6 0 8 29:19
Blue wargasm Scout 31 21 8 292 230 8580 6754 0 5 0 49 0 11 29:19
Blue Supreme Scout Sniper 18 15 5 160 189 4693 5544 0 5 0 25 4 4 29:19
Blue bohoc Soldier 22 16 7 327 252 9615 7393 0 4 2 95 0 6 29:19
Blue 2pac Soldier Sniper 12 19 7 282 257 8277 7552 0 3 0 50 2 5 29:19
Blue :D Demo 27 19 14 402 344 11792 10103 0 4 4 32 0 5 29:19
Blue Muffinz Medic 0 11 19 15 139 446 4079 0 0 0 8 0 6 29:19
Team Player Classes K D A DA/M DT/M HR/M DA DT HR K/1 AS MS HSK CPC Time Played

Totals

Team/Round K D A DA/M DT/M HR/M DA DT HR K/1 AS MS HSK CPC Duration
Red 101 110 46 1413 1480 1120 41425 43403 32852 6 6 180 0 37 10 29:19
Blue 110 101 60 1480 1413 1001 43403 41425 29350 5 6 259 6 37 11 29:19

Medics

Team Player Class H% H/M H MÜ KÜ OÜ D AL BAL DAÜ DBÜ Time Played
Red 639 Hz Medic 100% 1120 32852 18 18 0 0 0 1 0:15 4 0 29:19
Blue Muffinz Medic 100% 1001 29350 21 7 14 0 0 0 0:00 8 0 29:19

Events

Kills

Team Player Scout Soldier Pyro Demo Heavy Engineer Medic Sniper Spy Total
Blue wargasm 11 12 0 7 0 0 1 0 0 31
Red `.` 11 12 0 3 0 0 3 1 0 30
Blue :D 8 10 0 3 0 0 6 0 0 27
Red technical. 10 7 0 4 0 0 2 0 0 23
Blue bohoc 8 11 0 2 0 0 1 0 0 22
Red wardex 3 5 0 6 0 0 4 2 0 20
Blue Supreme 7 7 0 2 0 0 2 0 0 18
Red rm -rf /* 5 5 0 4 0 0 1 0 0 15
Red Pipoex 4 5 0 2 0 0 1 1 0 13
Blue 2pac 3 6 0 3 0 0 0 0 0 12

Deaths

Team Player Scout Soldier Pyro Demo Heavy Engineer Medic Sniper Spy Total
Red wardex 12 11 0 7 0 0 0 1 0 31
Red rm -rf /* 9 7 0 3 0 0 0 3 0 22
Blue wargasm 11 8 0 2 0 0 0 0 0 21
Blue 2pac 6 12 0 1 0 0 0 0 0 19
Blue :D 8 9 0 2 0 0 0 0 0 19
Red Pipoex 8 4 0 3 0 0 0 2 0 17
Blue bohoc 6 6 0 4 0 0 0 0 0 16
Red technical. 5 4 0 5 0 0 0 1 0 15
Red `.` 5 5 0 3 0 0 0 2 0 15
Blue Supreme 4 8 0 3 0 0 0 0 0 15
Blue Muffinz 3 7 0 1 0 0 0 0 0 11
Red 639 Hz 2 1 0 6 0 0 0 1 0 10

Assists

Team Player Scout Soldier Pyro Demo Heavy Engineer Medic Sniper Spy Total
Blue :D 14 17 0 4 0 0 6 0 0 41
Blue wargasm 15 15 0 7 0 0 2 0 0 39
Red technical. 13 14 0 5 0 0 3 0 0 35
Red `.` 13 13 0 4 0 0 4 1 0 35
Blue bohoc 11 13 0 3 0 0 2 0 0 29
Red wardex 4 7 0 8 0 0 4 2 0 25
Blue Supreme 8 11 0 2 0 0 2 0 0 23
Red rm -rf /* 11 5 0 5 0 0 1 0 0 22
Red Pipoex 5 8 0 6 0 0 1 1 0 21
Blue Muffinz 5 9 0 3 0 0 2 0 0 19
Blue 2pac 4 9 0 5 0 0 1 0 0 19
Red 639 Hz 2 3 0 2 0 0 2 0 0 9

Killstreaks

serveme.tf #1340967

Time Team Player Kills
6:06 Blue :D 4
7:29 Blue Supreme 3
11:18 Red `.` 3
15:33 Blue :D 4
17:00 Blue :D 3
22:23 Red `.` 4

Chat

serveme.tf #1340967

Team Player Message
Red `.` ACCGTGTGTACAGCATCGCACATCAGCCTTTTTT
Red Pipoex is it dna sequence?
Red `.` nigga gene
Red `.` 2PAC DOWN GUYS PUSH TO THE STUDIO
Red wardex my cat is so annoying
Red wardex he wants 50 meals a day
Red Pipoex GTCCATCTGTGCATACT
Red 639 Hz gigacat
Red technical. 8)
Red wardex i knew it too T_T
Console Thanks for using serveme.tf technical.! Have you considered donating to keep this service alive?
Red `.` -155?
Red Pipoex :D:D:D
Red Pipoex uhuhuuuuuuuuuuuu
Red wardex aw cmon
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Console WARNING: 2pac currently playing SNIPER while not allowed. Switch back to ROAMER within 30 seconds or get punished...
Red Pipoex gg
Red rm -rf /* gg
Red technical. gg
Blue wargasm gg